Редактирование: Guide to genetics (раздел)

==== Using a CRISPR Charge ====
You'll need the top row of the sequence pairs of both the mutation you want to target and the mutation you want to replace it with. Here's the basic flow:
* Solve the mutation you want or just use a mutator on a humanized monkey
* Take note of the top row
* On the subject you want to swap mutations on, solve the mutation you want to swap
* Use a CRISPR charge on it
* Feed in a special CRISPR string instructing the virus to replace that mutation with the desired mutation

===== Building the CRISPR String =====
For example, let's say Epilepsy is
* '''<code>A T T A C G C G A T T A C G C G</code>'''
* '''<code>T A A T G C G C T A A T G C G C</code>'''

And Telekinesis is
* '''<code>A T A T C C G G A T T A C C G G</code>'''
* '''<code>T A T A G G C C T A A T G G C C</code>'''

Take note of the first row of both
* Epilepsy is '''<code>A T T A C G C G A T T A C G C G</code>'''
* Telekinesis is '''<code>A T A T C C G G A T T A C C G G</code>'''

You then need to weave these rows together, old-new-old-new-old-new like this:
* '''<code>_A T A T C C G G A T T A C C G G :NEW (Telekinesis)</code>'''
* '''<code>AATTTAATCCGCCGGGAATTTTAACCGCCGGG :CRISPR String</code>'''
* '''<code>A T T A C G C G A T T A C G C G_ :OLD (Epilepsy)</code>'''

Now, when you use CRISPR on the solved base mutation you intend to swap, feed in that string! It swaps ''Epilepsy'' out for ''Telekinesis''.
* '''<code> AATTTAATCCGCCGGGAATTTTAACCGCCGGG </code>'''

If your string is not the right length, nothing happens, but if the string is wrong, you may end up with ''Acid Flesh'' instead, but scrambled and with no guides - hope you've got activators! Careful not to be wrong multiple times, lest you overwrite multiple mutations to the same one and need to shuffle to get them back.

Also, the CRISPR charge, being a repurposed virus, might sometimes go rogue and infect you randomly.

<br><br> Congratulations. If you read everything in this guide, you should now be a full-fledged Geneticist.